>Promoters of the regulated genes
>1|P43463|HTH-type transcriptional activator aarP|Providencia stuartii|AraC
aac(2')-Ia promoter. Bases around position -47 are important for activation. The GCA motif centered at position -47 could be equivalent to the GCAY motif that is proposed to be important in SoxS binding.
>2|P34000|HTH-type transcriptional regulator acrR (Potential acrAB operon repressor)|Escherichia coli O6|TetR
Transcription of acrAB, upregulated by slow growth, is typical of a gearbox regulated gene and it is interesting to note that th -10 region of the acrAB promoter sequence (-CGAGGTTT-) resembles a gearbox-type sequence homology rather than a sigma-70 consensus sequence.
>5|P06134|ADA regulatory protein (Regulatory protein of adaptative response) [Contains: Methylated-DNA--protein-cysteine methyltransferase (EC 2.1.1.63) (O-6-methylguanine-DNA alkyltransferase)]|Escherichia coli|AraC
Ada, aidB and alkA promoters are the targets of the Ada protein.
The Ada promoter directs the transcription of both the ada gene and the alkB gene. The location of the Ada binding site is at -57 to -45.
The Ada protein binds the aidB promoter between -55 and -43.
The Ada protein binds the alkA promoter between -47 and -35.
>9|Q9ZN78|A-factor receptor protein (A-factor binding protein)|Streptomyces griseus|TetR
The adpA transcriptional start point is a C located 263 bp upstream of the initiation codon.
Although -35 or -10 consensus sequence typical of prokaryotic promoters was not present in front of the start point, CAGGCA and TACGCT with 16 bp space are somewhat similar to one type (TTGACA for -35 and TAGGAT fro -10 with 18 bp space) of Streptomyces promoters, which is believed to be active during vegetative growth.
The promoter region of adpA binds ArpA in absence of A-factor.
The -35 and -10 regions of the adpA promoter overlaps with a consensus for ArpA binding, that spans from -28 to -7 residues,(-28) AGGAACGGACCGCGCGGTACGC (-7).
>15|P03021|Arabinose operon regulatory protein|Escherichia coli O157:H7|AraC
ParaBAD, ParaE and ParaFGH. The consensus sequence AGCN7TCCATA is conserved in all sites of AraC binding and appears as a tandem repeat.
ParaBAD: In the absence of arabinose one monomer of the AraC dimer occupies the araI1 site while the other occupies a half-site approximately 200 bp away, known as araO2. The dimer bound to target sequences in this way generates a DNA loop, which prevents transcription from ParaBAD and ParaC. When arabinose is added, the AraC protein undergoes a conformational change and shifts to occupy the adjacent half-sites araI1 and araI2 and, as a result, ParaBAD is induced.
At araBAD, the CRP-binding site ends 59 bp from the -10 signal.
ParaFGH: The configuration of the AraC at the araFGH promoter is similar to MarA at a Class I promoter. The AraC binding site of araFGH ends 49 bp upstream from the -10 signal and is in the reverse orientation from that at the Class II araBAD promoter. At araFGH the CRP-binding site end 18 bp from the -10 signal.
>25|P17446|HTH-type transcriptional regulator betI|Escherichia coli|TetR
The non coding region between betT and betIBA has 128 bp and contains the betT and betIBA promoters, divergently oriented and partially overlapped in their -35 boxes. This regions also contains the operator sequence for BetI and a putative ArcA binding site.
The betIBA genes are cotranscribed from the betI promoter.
The putative betI promoter sequence is:[ttgaacGTCCAATCAATAACCGCtttaatAGATAAa(-27)]-> betIAB, with the transcription start point located at 27 bp upstream from the first codon of the betI gene (numbering refers to the translational start codon of the BetI).
The putative betT promoter is:betT<-[(-42)gCATTGTtaattcTGTGTAAAATATAACTTgcaggt](numbering refers to the translational start codon of the betT gene).
>35|P43506|HTH-type transcriptional repressor Bm3R1|Bacillus megaterium|TetR
P450BM-3 gene has two promoters, the strong barbiturate-activated promoter, P2 from which bm3R1 and P450BM-3 are cotranscribed, and the promoter P1, much weaker than P2 and situates just upstream of the P450BM-3 gene.
The gene bm3R1 is transcribed from the strong barbiturate-activated promoter, P2 with its transcriptional start site located 44 bp upstream from the translation start codon of the bm3R1 gene:[tttactATTAAGATGCAGTTTTTtatactTGTAATTGt(-44)]->Bm3R1.
From P2 are transcribed the genes bm3R1 and P450BM-3 that form a cotranscriptional unit.
The Bm3r1 operator, OIII, is a 20 bp palindromic sequence located between the promoter P2 and the translation start codon of bm3R1, exactly at 22 bp upstream of this site and 3 bp downstream to the transcription start site: [CGGAATGAACGTTCATTCCG(-22)](Numbering refers to the translational start codon of the bm3R1 gene).
The binding of Bm3R1 protect from DNaseI digestion a region spannig about 26 bp, covers and flanks the 20 bp palindromic operator sequence (OIII).
The bm3R1 and P450BM-3 genes form a cotranscriptional unit regulated by the bicistronic operator OIII.
Bm3R1 binds a sequence within the coding sequence of the gene bm3R1. This sequence is named BB3 (Barbie Box element):[(+364)ATCAAAAGCTGGTGG]Numbering refers to the translational start codon of the bm3R1 gene).
With regard with P450BM-1, this gene is situated next and divergently oriented to bm1P1 gene (267 bp). Between them there are two promoters, the promoters for the P450BM-1 and bm1P1 genes, that overlap in the -35 regions. The sequence of the promoter of the bm1P1 gene is: bm1P1<-[(-48)aTCTGCCTTTTCCTACGTGAattttaTCCTTTTTCCTTGATaaccaa] (numbering refers to the bm1P1 translational start codon). The sequence of the promoter of the P450BM-1 gene is: [ttgataACCAAGTAAAAATAATTAtatactATTAGTACa(-145)]-> P450BM-1 (numbering refers to the P450BM-1 translational start codon).
Bm3R1 binds three sequences in the bm1P1/P450BM-1 genetic region. Two of them, named OI and OII, are located in the bm1P1-P450BM-1 intergenic region. OI over the -35 boxes of the promoters of both genes and OII located between the -10 box of the promoter of the P450BM-1 and its coding sequence. These binding sites coincide with inverted repeats, OI with the 25 bp inverted repeat and OII with the 53 bp inverted repeat:[TTTTTCCTTGATAACCAAGTAAAAA] (25bp) and [TATACTATTAGTACATTTTTATACTAATTGTATAAAAATGTACTAATAGTATA](53bp). The third Bm3R1 binding site of this set is the BB1 (Barbie Box element), located within the coding sequence of the gene bm1P1:[ATAAAAAGCTGGTGC(+36)](numbering refers to the bm1P1 translational start codon).
Barbie box elements are a type of DNA sequences 15-17 bp long, situated at the 5’ regulatory regions of all, eukariotic and prokaryotic genes that encode barbiturate-inducible proteins. All the Barbie box elements have a 4 bp sequence, AAAG, situated in the same relative position.
>38|P25393|CFA/I fimbrial subunit D (Colonization factor antigen I subunit D)|Escherichia coli|AraC
CfaD activates the promoter in front of the cfaA gene on region 1.
>44|Q9ZFU7|HTH-type transcriptional regulator eutR (Ethanolamine operon regulatory protein)|Salmonella typhimurium|AraC
The main regulated promoter is PI which is located at the beginning of the eut operon.
AdoB12 is present and requires CRP protein as a global regulator.
>45|P26993|Exoenzyme S synthesis regulatory protein exsA|Pseudomonas aeruginosa|AraC
Pd, Ps, and Porf1. PD promoter drives transcription of exsD, and perhaps other downstream genes. PS promoter controls the exoS transcription.
DNase I footprint analysis of the promoter regions bound by ExsA revealed a common protected consensus sequence of TXAAAAXA. The consensus sequence was located 51 bp upstream of the transcriptional start sites for Pd, Ps, and Porf1.
>46|P23774|987P fimbrial operon positive regulatory protein fapR|Escherichia coli|AraC
fpaC promoter.
>64|P39437|Invasion protein invF|Salmonella typhimurium|AraC
There is an InvF-dependent promoter immediately upstream of sicA.
>69|O33813|Lactose operon transcription activator|Staphylococcus xylosus|AraC
The lacPH genes are cotranscribed from one promoter in front of lacP. The lacPH promoter was found 46 bp upstream of the lacP start codon.
>72|P21308|HTH-type transcriptional regulator luxR|Vibrio harveyi|TetR
The start site for the luxCDABEGHI mRNA, in Vibrio harveyi, is 26 bases upstream of the initiation codon of the first gene luxC. This transcription start site has a -10 box, ATTAAT, in good agreement with the -10 boxes recognized by sigma-70, although no conserved -35 box was identified: [ACTTTAAAAAAATGATCCAAGGAattaatGTTTTCc]->luxC.
There is a second transcription start site 123 bp upstream of the initiation codon of the first gene luxC. This transcription start site has a -10 box, TATAAT, in good agreement with the -10 boxes and a -35 box showing some homolgy to -35 hexamer: [ttacgaCTAATTATAGATAAGAAGAACtataatTAAATTa].
It seems that LuxR affects to the the transcription start site used.
DnaseI footprinting analysis show that LuxR protects two regions upstream of luxC gene. The first region spans from -253 to -290 and the second one, from -116 to -170, relative to the luxC start codon. Although the sizes of the regions differs, both are A-T rich and contains the octamer AGTGTTA.
>73|P27246|Multiple antibiotic resistance protein marA|Escherichia coli O157:H7|AraC
MarA binds to a specific DNA sequence 'marbox', in the vicinity of the promoters of controlled genes.
>78|P10411|Melibiose operon regulatory protein|Escherichia coli O6|AraC
MelR binds to two identical 18 bp sequences at the PmelAB promoter. These sequences are organised as an inverted repeat separated by 20 bp, located between -54 and -110 with respect to the transcription start.
>80|P28809|MmsAB operon regulatory protein|Pseudomonas aeruginosa|AraC
The transcription start site of he mmSA operon is located 77 bp upstream from the A of the first ATG translational codon of mmsA.
>82|P39897|HTH-type transcriptional regulator mtrR|Neisseria gonorrhoeae|TetR
The transcription start point of the mtrCDE promoter is 161 bp upstream of the first codon of the mtrC gene and the -10 and -35 boxes are, (-8)ATTATA, 15 ,GGATAA(-34): mtrC <-[tGGGTTTCattataCATACACGATTGCACggataa(-34)] (The numbering refer to the TSP located 161 bp upstream from the first ATG of the gene mtrC).
The 13 bp inverted repeat sequence overlaps with the last two bp of the -35 box of the mtrCDE promoter, GGATAA:[ggataaAAAGTCTTTTT(-15)](The numbering refer to the TSP of the mtrR gene, 30 bp upstream from the first ATG).
>93|P40883|Regulatory protein pchR|Pseudomonas aeruginosa|AraC
The heptameric CGAGGAA sequence identified upstream of the putative -35 region of fptA could be the binding site for PchR.
>97|Q05587|Regulatory protein pocR|Salmonella typhimurium|AraC
PocR activates the transcription from four promoters located in the region between pdu and cob: PPdu, P1, P2, and PCob. PPdu is the regulated promoter of pdu operon, P1 and P2 are the promoters of pduF and pocR, and PCob is the promoter of the cob operon regulated by pocR.
>100|P23217|HTH-type transcriptional regulator qacR|Staphylococcus aureus subsp. aureus Mu50|TetR
The intergenic qacR-qacA region contains the promoter of both genes and an QacR operator sequence, IR1.
The qacA transcription start point is a G located 39 bp upstream of the first codon of qacA.
The qacA promoter sequence is: [ttgtaaTATGTAAAAAAATAGATtataatCCTTATAg]-> qacA.
The QacR operator sequence, named IR1, is adjacent to the qacA promoter region.  IR1 is a 28 bp pseudopalindromic sequence that overlaps the qacA transcription start point (g). IR1 contains two 11 bp half-sites, wich are separated by a 6 bp  spacer. The sequence of IR1 is: [CTTATAgACCGATCGCACGGTCTATAAG].
>108|P09378|L-rhamnose operon transcriptional activator rhaR|Escherichia coli|AraC
Psr promoter.
>110|P09377|L-rhamnose operon regulatory protein rhaS|Escherichia coli|AraC
DNA-binding site for RhaS(rhaI) is located at a region spanning from -32 to -81 with respect to the rhaBAD transcription start site. The RhaS binding site is an inverted repeat of two 17-bp half-sites: rhaI1 and rhaI2 separated by 16bp of uncontacting DNA.
RhaS makes all of its sequence-specific DNA contacts within major grooves.
>114|P16114|Regulatory protein rns|Escherichia coli|AraC
Rns binds at two separate sites upstream of the Pcoo promoter (the promoter of CS1 pilin genes). At each site, Rns recognizes asymmetric nucleotide sequences in two regions of the major groove, and binds along one face of the DNA helix. Both binding sites are required for activation of Pcoo in vivo. These sites are centered at -112 (site I) and -37.5 (site II) promoter -10 hexamer. Mutations at the promoter proximal site reduced Rns-dependent transcription from Pcoo more than mutations in the distal site.
>115|P27292|Right origin-binding protein|Escherichia coli O157:H7|AraC
Rob and the related transcription factors SoxS and MarA bind to asymmetric DNA sequences within the promoter regions of the regulated genes. These binding sites are composed of two conserved sequence motifs, called the A-box and B-box, separated by a 20 bp variable sequence.
>118|Q9R3W3|Transcriptional regulator sirC|Salmonella typhimurium|AraC
SprA acts either upstream or at the same level as HilA in the SPI-1 transcriptional regulatory cascade.
>122|P39885|HTH-type transcriptional regulator tcmR (Tetracenomycin C transcriptional repressor)|Streptomyces glaucescens|TetR
The tcmA gene has a promoter which transcription start site 57 bp upstream of the translational start point of tcmA that is consistent with the presence of -10 and -35 regions:[ttgtcaAATGTCACTGACTGCTGTtagcttCGGGGCCa(-57)]->tcmA. This promoter shows a high degree of similarity to the Streptomyces vegetative promoter consensus.
It seems that, in the tcmA-tcmR intergenic region, are two adjacent operator sequences, one of which overlaps the tcmA promoter and the other of which overlaps the tcmR-p1 promoter, perhaps separated by a few base pairs between the -35 regions of tcmA and tcmR-p1 promoters.
>124|P03038|Tetracycline repressor protein class A from transposon 1721|Escherichia coli|TetR
The tetR-tetA intergenic region contains the two overlapping promoters and two similar palindromic sequences that act as operators, tetO1 and tetO2.
tetO1 is 10 bp upstream from the transcription start site of the gene tetR. The sequence of tetO1 is: [(-10)TTTATCACTGATAAA(-24)].
tetO2 is 4 bp downstream from the transcriptional start site of the gene tetA. The sequence of tetO2 is: [(+4)TTATCAGTGATAA(+16)].
>126|P04483|Tetracycline repressor protein class B from transposon Tn10|Escherichia coli|TetR
The tetR-tetA intergenic region contains the two overlapping promoters and two similar palindromic sequences that act as operators, tetO1 and tetO2.
tetO1 is 8 bp upstream from the transcription start site of the gene tetR. The sequence of tetO1 is: [(-8)ACTCTATCATTGATAGAGT(-26)].
tetO2 is 1 bp downstream from the transcriptional start site of the gene tetA. The sequence of tetO2 is: [(+1)TCCCTATCAGTGATAGAGA(+19)].
>127|P03039|Tetracycline repressor protein class C|Escherichia coli|TetR
The tetR-tetA intergenic region contains the two overlapping promoters and two similar palindromic sequences that act as operators, tetO1 and tetO2.
tetO1 is 4 bp downstream from the transcription start site of the gene tetR. The sequence of tetO1 is: [(+4)TCGAATAGCTACTATTCGA(+22)].
tetO2 is 1 bp upstream from the transcriptional start site of the gene tetA. The sequence of tetO2 is: [(-1)AGTTTATCACAGTTAAATT(+18)].
>128|P09164|Tetracycline repressor protein class D|Escherichia coli|TetR
The tetR-tetA intergenic region contains the two overlapping promoters and two similar palindromic sequences that act as operators, tetO1 and tetO2.
tetO1 is 5 bp upstream from the transcription start site of the gene tetR. The sequence of tetO1 is: [(-5)CTCTATCATTGATAGGG(-21)].
tetO2 is 4 bp upstream from the transcriptional start site of the gene tetA. The sequence of tetO2 is: [(-4)CTCTATCAATGATAGGG(+13)].
>145|P32326|Urease operon transcriptional activator|Escherichia coli|AraC
A urea-inducible promoter (PureD) was identified upstream of ureD gene. Transcription from this promoter was activated only when UreR was present in trans. There are two additional urea and UreR-dependent promoters within the plasmid-encoded urease locus: PureR and PureG.
>146|Q02458|Urease operon transcriptional activator|Proteus mirabilis|AraC
ureD promoter.
>166|P07859|XylDLEGF operon transcriptional activator|Pseudomonas putida|AraC
Activated XylS stimulates transcription from the meta-pathway operon promoter Pm.
In Pm XylS binds to a direct repeat TGCA(N6)GGNTA located between -70 and -56 and between -49 and -35.
>167|Q04710|XylDLEGF operon transcriptional activator 1|Pseudomonas putida|AraC
Pm1 (meta-1 operon) and Pm2 (meta-2 operon).
>170|Q05335|XYLDLEGF operon transcriptional activator 3|Pseudomonas putida|AraC
Pm1 (meta-1 operon) and Pm2 (meta-2 operon).
>248|O30343|Hemagglutinin/protease regulatory protein|Vibrio cholerae|TetR
DNaseI foot-printing showed that purified HapR binds to the aphA promoter, between -85 and -58 [TCATTATTGAGAATAATGTCAGTTTTTA].
>253|O33453|CymR|Pseudomonas putida|TetR
The sequence upstream of cymB contains a putative sigma-70 promoter region with its hypotetical -10 element located 77 bp upstream of the first codon of the cymB gene: [ttgacTCAGGAGTTTTTCAGCCGgatgat(-77)].
The sequence upstream of cmtAa contains a putative sigma-70 promoter region with its hypotetical -10 element located 96 bp upstream of the first codon of the cmtAa gene: [ttgacaGGTGAATTCGAGGCGGATgatttt (-96)].
Comparison of the putative regulatory sequences upstream of the cym and cmt operons revealed that both contain a sequence located between the -35 and -10 promoter elements at the begining of both genes that could act as an operator for the CymR repressor protein:[(-74)CGCGACAAGAAAGAAACAAACCAACCTGTCTGTATTATCT(-39)], putative cym/CymR binding site. [(-95)TTTGAAAACAAACAGACAATCTGGTCTGTTTGTATTATAA(-56)], putative cmt/CymR binding site.
CymR binds to the regulatory sequence upstream of the cmt operon of Pseudomonas putida F1.
The T at position -68 in the 27 bp palindromic sequence of the cmt promoter is essential for CymR binding.
>255|O51847|Regulatory protein|Pseudomonas putida|AraC
The DNA sequence of the ipb operator-promoter is similar to the same region of the TOL plasmid meta operon.
>259|O52846|XylS/AraC transcriptional regulator|Bacillus megaterium|AraC
Direct imperfect repeats constitute a putative regulator binding site for BgaR.
>262|O68276|Putative DNA-binding protein Bm1P1|Bacillus megaterium|TetR
Primer extension experiments demonstrated that the transcription start point for the P450BM-1 gene is at position 147 bp upstream from the first codon of the gene.
This transcription start point is at an appropriate distance from a putative sigmaA-like promoter:ttgataACCAAGTAAAAATAATTAtatactATTAGTACa.
The -10 region of this promoter and its downstream sequence overlap with the 53 bp inverted repeat.
This promoter was experimentally proved.
The 53 bp inverted repeat is important for the negative regulation of P450BM-1 gene.
>278|P72185|Repressor protein|Propionibacterium freudenreichii|TetR
The 50 bp intergenic region between the hemX and hemR genes contains promoter-like sequences upstream from both genes, indicating that hemX and hemR may be transcribed divergently from overlapping promoters (in their -35 elements): hemX<-[ACaacataGGCGCGTAAGATAGtggacgcaaGCGATCACAATGAGtactttCG]->hemR.
>279|P72312|Nitrilase regulator|Rhodococcus rhodochrous|AraC
The nitA promoter has an inverted repeat sequence centered at -52.
>291|Q8KLP4|Repressor|Stenotrophomonas maltophilia|TetR
The transcription start point of the smeD gene is 139 bp upstream from the first SmeD codon, the -10 and -35 elements are: [tttacaAACAAACAAGCATGTATGtatattTCGCACCCATCa(-139)]->smeD.
>310|Q8KX64|Luminescence regulator LitR|Vibrio fischeri|TetR
The luxR promoter sequences were ATGTCA for the -35 and GATATA for the -10 elements, which were separated by 18 bp.
LitR is able to bind a region of DNA that encompasses the Vibrio fisheri luxR promoter.
>328|Q8VQC6|VanT|Listonella anguillarum|TetR
The genes sat and vps73 are an operon, with sat situated upstream of vps73. This operon has two promoters, p1 immediately upstream of sat and p2, promoter of vps73, situated within the coding sequence of sat.
The genes hpdA and hgdA are an operon, with hpdA situated upstream of hgdA. This operon has a promoter immediately upstream of hpdA.
>335|Q8VVJ2|TetR protein|Corynebacterium glutamicum|TetR
The intergenic region between tetR(33) and tetA(33) contains a 14 bp inverted repeat showing a 23 bp identity to the operator binding sites OL and OR of the TetR(A) protein from Tn1721: [TTTATCAtcGATAActTTATCgttGATAAG] (Uppercase means identity to the OL and OR from Tn1721).
>368|Q93M20|Putative transcriptional regulator|Streptomyces aureofaciens|TetR
There is a single promoter upstream the aur1A gene, aur1p1, that probably forms a polycistronic transcript.
The promoter region upstream the aur1A gene has a transcription start site 43 bp upstream of the aur1A translation initiation codon: [ttgaacGGCCGCTCGCGTCCGAAgaacctTGTAGTCaa(-43)].
The putative -10 and -35 regions of the aur1p1 promoter show partial similarity with consensus sequences of the promoters recognized by the Streptomyces principal sigma factor, sigmaHrdB, and its induction occurs at the initiation of morphological differentiation (aerial mycelium formation).
>387|Q46985|Regulator of the 4HPA-hydroxylase operon|Escherichia coli|AraC
pbc promoter.
>388|Q47074|BfpT protein|Escherichia coli|AraC
The BfpT protein binds to the sequence between nucleotides -94 and -55 with respect to the bfpA transcription start site.
>393|Q51597|Cam repressor|Pseudomonas putida|TetR
The promoter region of the camDCAB is:[ttgaccACACTCCTTCTCGCCAAtatgctCAGTAt].
Transcription from the camDCAB promoter is not mediated by RNA polymerase with sigma-70.
>407|Q56790|HrpXv|Xanthomonas campestris pv. vesicatoria|AraC
Upstream and in close vicinity to the transcription site of hrpB, hrpC, hrpD and hrpF is the PIP box that consists of a direct repeat with a spacing of 15 nucleotides.
>416|Q60011|Virginiae butanolide receptor|Streptomyces virginiae|TetR
There are at least two BarA binding sites in the upstream region of barB.
>841|Q9AIU0|Regulatory protein TtgR|Pseudomonas putida|TetR
The ttgR-ttgA intergenic region contains the promoter of each gene, PttgR and PttgA. The localion of the start sites indicates that the both promoters fully overlaps.
The -10 region of PttgR and PttgA exhibits some degree of similarity to promoters recognized by RNA polymerase with sigma 70 and lower similarities in their -35 regions.
The sequence of the PttgA is:[acaaacAACCATGAATGTAAGTAtattccTTAGCa]->ttgA.
TtgR binds a 28 bp imperfect palindromic sequence in the ttgR-ttgA intergenic region, that covers from 18 bp upstream to 10 bp downstream of the ttgR transcription start site: [TACTTACATTCATATAAgGAATCGTTCG]. These 28 bp sequence overlaps with the -10 region of the ttgR promoter, the ttgR transcription start site, and the -35 region of the ttgA promoter.
>844|Q9AJL5|VarR|Streptomyces virginiae|TetR
VarR specifically binds to the 5’ upstream region of varS.
>852|Q9ANS7|LuxT|Vibrio harveyi|TetR
LuxT binds the luxO promoter region.
Footprint analysis showed that LuxT bound to a region located between nucleotides 117 to 149 upstream of the luxO translational start codon: [TTCGGTTTACTTTGTTTAGAATACCCACAGTCT].
The GTTTA repeats in the footprint region might be a recognition sequence for LuxT.
>862|Q9EVJ6|Repressor protein MphR(A)|Escherichia coli|TetR
A single transcription start site is located 31 bp upstream from the translation initiation site of mph(A). There are -35 and -10 elements from this transcription start site that resemble the consensus sequences, TTGAat and TacAtT, repectively:[ttgaatATAACCGACGTGACTGTtacattTAGGTGg(-31)]-> mph(A).
The mph(A), mrx and mphR(A) genes form and operon and are cotranscribed from the promoter of the mph(A) gene.
>866|Q9F0Y2|Pip|Streptomyces coelicolor|TetR
Two regulatory Pip binding motifs were found in the intergenic pip/pep region, upstream of the pep coding sequence. These sequences overlaps with the -35 and the -10 hexamers.
>903|Q9KIH5|Putative regulator|Rhizobium etli|TetR
The rmrR/rmrA intergenic region contains a potential rmrA promoter with -35 and -10 consensus sequences for sigma-70. The first nucleotide of the -10 region is situated 88 bp from the start codon of rmrA:[ttgacaTTCTTTTTTTAAAGCAtatttt(-88)]->rmrA.
>921|Q9L7Y6|BenR|Pseudomonas putida|AraC
Pm promoter and benA promoter. The benA promoter region contains a direct repeat sequence.
>923|Q9L8G8|SmcR (VvpR)|Vibrio vulnificus|TetR
The vvhBA genes are cotranscribed from a single transcription start site (TSP) that is located 115 bp upstream of the translational initiation codon. The putative promoter upstream of this TSP is named Pvvh. The promoter sequence determined according to the TSP was TTTATA for the -35 and TATTAA for the -10 sequences, wich were separated by 17 bp: [tttataTGAAATATTTTCAGGATtattaaTAAATAg(-115)]->vvhB.
The vvhBA regulatory region, contains a CPR binding site: [(-67)TGTGACAGTGAGCCAAAA(-50)].
>1001|Q9X545|Tetracycline repressor protein TetR|Corynebacterium glutamicum|TetR
The tetR(Z)-tetA(Z) intergenic region contains the two 12 bp direct repeats with a 10 bp identity to the operator binding site of the tetracycline repressor TetR(A).
>1012|Q9XCC7|Gamma-butyrolactone receptor protein TylP|Streptomyces fradiae|TetR
In the intergenic DNA upstream of tylQ exits a putative BARE-like consensus sequence (target for binding of BarA and other gamma-butyrolactone receptor proteins. May be that the binding of TylP to the promoter region of tylQ occurs to this putative sequence.
In the intergenic DNA upstream of tylS exits a putative BARE-like consensus sequence (target for binding of BarA and other gamma-butyrolactone receptor proteins. May be that the binding of TylP to the promoter region of tylS occurs to this putative sequence.
>1020|Q9Z3Y6|PhbR|Pseudomonas sp. 61-3|AraC
There is a promoter (Pphb) in the upstream region of phbB and the transcription from this promoter is activated by phbR.
>1368|O30507|Arginine regulatory protein (Transcriptional regulator ArgR) (ArgR regulatory protein)|Pseudomonas aeruginosa|AraC
Alignment of ArgR binding sites reveals that the ArgR binding site consists of two half-sites, in a direct repeat arrangement, with the consensus TGTCGCN8AAN5 sequence.
ArgR binds to two promoters, P1 and P2, to control the aot operon. The downstream promoter, P2, is induced by arginine and appears to be subject to carbon catabolite repression (i.e. succinate). The upstream promoter, P1, is induced by glutamate.
The aruCFGDB genes appear to form an operon transcribed from a promoter upstream of aruC, whereas aruE has its own promoter.
Transcription of gdhB is initiated at an adenine residue located 195bp upstream from the ATG initiation codon.
ArgR protects a region of 45 to 47 bp that overlaps the promoters for the biosynthetic car and argF operons, indicating that ArgR exerts its negative control on the expression of these operons by steric hindrance.
>1431|O86852|Gamma-butyrolactone binding protein|Streptomyces coelicolor|TetR
The non coding region between scbA and scbR genes contains the scbA promoter. The transcription start point (TSP or +1) is 47 bp from the scbA start codon. The -10 and -35 boxes of scrA promoter are (-8)TTCTAT, 17, AAAGAT(-36)(numbering from the transcription start site): scbA<-[cTTGCAAttctatGTCTGACTCGCCAAAAAaaagat].
There is a 30 bp. ScbR binding sequence, named ScbR binding site A, that covers the scbA promoter region: [(-4)CAATTCTATGTCTGACTCGCCAAAAAAAAG(-33)](numbering from the transcription start site).
>2160|Q53901|ActII protein (Putative transcriptional regulatory protein)|Streptomyces coelicolor|TetR
The actII-1 actII-2 intergenic region is a bidirectional promoter/operator region.
The actII-1 and actII-2/3 transcripts each have a single promoter and the promoters for the two transcripts overlap.
actII-2 and actII-3 are translationally coupled.
>4196|Q9F8V9|TetR family bacterial regulatory protein|Agrobacterium tumefaciens|TetR
The gene ameC might have an additional promoter.
>4926|16077337|transcriptional regulator|Bacillus subtilis subsp. subtilis str. 168|TetR
The lmrA and lmrA have the same promoter situated upstream of the first gene.
>6853|19552090|transcriptional regulator|Corynebacterium glutamicum ATCC 13032|TetR
Compared with the promoter consensus sequence defined for Corynebacterium glutamicum, a putative -10 consensus sequence was identified, whereas no similarity with the described -35 was found.
There are two sequences upstream the amt gene to which AmtR binds, consisting of the sequence ATCTATAGN4ATAG. The sequence designated amt1 (ATCTATAGAACGATAG) is located between positions -97 and -86 with respect to the ATG start codon of amt. Motif amt2 (ATCTATAGCGGATAG)is at position -61 to -46.
In the wild type two transcription start points were detected 56 and 53 bp upstream the ATG start codon of amt. Both transcription start points are located at the amt2 motif.
In a amt2 deletion mutant strain, amt expression was still under the control of AmtR and transcription started upon nitrogen starvation 39 bp upstream the amt gene.
>6871|19554126|transcriptional regulator|Corynebacterium glutamicum ATCC 13032|TetR
McbR binds to the putative promoter region of the metY gene.