>Promoters of the gene coding the protein
>2|P34000|HTH-type transcriptional regulator acrR (Potential acrAB operon repressor)|Escherichia coli O6|TetR
The non coding region between acrR and acrA has 128 bp and contain the acrR and acrAB promoters.
The upstream region of the acrAB operon contains a candidate AcrR operator sequence. It is a perfect palindrome of 24 bp that overlaps with the acrAB promoter.
There is a MarA binding site upstream of the acrAB operon. This binding site is located in the coding region of acrR.
There is a MarA binding site upstream of tolC.
>5|P06134|ADA regulatory protein (Regulatory protein of adaptative response) [Contains: Methylated-DNA--protein-cysteine methyltransferase (EC 2.1.1.63) (O-6-methylguanine-DNA alkyltransferase)]|Escherichia coli|AraC
Ada promoter.
>13|P05052|HTH-type transcriptional regulator appY (M5 polypeptide)|Escherichia coli|AraC
The sequence of the appY gene and its promoter region is unusually AT rich.
>15|P03021|Arabinose operon regulatory protein|Escherichia coli O157:H7|AraC
ParaC.
>25|P17446|HTH-type transcriptional regulator betI|Escherichia coli|TetR
The non coding region between betT and betIBA has 128 bp and contains the betT and betIBA promoters, divergently oriented and partially overlapped in their -35 boxes. This regions also contains the operator sequence for BetI and a putative ArcA binding site.
The putative betI promoter sequence is:[ttgaacGTCCAATCAATAACCGCtttaatAGATAAa(-27)]-> betIAB, with the transcription start point located at 27 bp upstream from the first codon of the betI gene (numbering refers to the translational start codon of the BetI).
The betIBA genes are cotranscribed from the betI promoter.
The BetI binding site is a 22 bp sequence that overlaps the -35 boxes of the promoters of the betT gene and the betIBA operon:[(-42)TTTTATATTGAACGTCCAATC(-21)] (numbering refers to the translational start codon of the BetI).
The BetI binding site contains two sequence of dyad symmetry: [TATTGAACGTCCAATCAAT(-48)] and [ATTGAACGTCCAAT(-50)].(numbering refers to the translational start codon of the BetI).
A putative ArcA binding site is at 97 bp upstream from the the translational start codon of the BetI, at the betT side of the overlapping promoters: [TATTTAA(-97).].
>35|P43506|HTH-type transcriptional repressor Bm3R1|Bacillus megaterium|TetR
P450BM-3 gene has two promoters, the strong barbiturate-activated promoter, P2 from which bm3R1 and P450BM-3 are cotranscribed, and the promoter P1, much weaker than P2 and situates just upstream of the P450BM-3 gene.
The gene bm3R1 is transcribed from the strong barbiturate-activated promoter, P2 with its transcriptional start site located 44 bp upstream from the translation start codon of the bm3R1 gene:[tttactATTAAGATGCAGTTTTTtatactTGTAATTGt(-44)]->Bm3R1.
From P2 are transcribed the genes bm3R1 and P450BM-3 that form a cotranscriptional unit.
The Bm3r1 operator, OIII, is a 20 bp palindromic sequence located between the promoter P2 and the translation start codon of bm3R1, exactly at 22 bp upstream of this site and 3 bp downstream to the transcription start site: [CGGAATGAACGTTCATTCCG(-22)](Numbering refers to the translational start codon of the bm3R1 gene).
The binding of Bm3R1 protect from DNaseI digestion a region spannig about 26 bp, covers and flanks the 20 bp palindromic operator sequence (OIII).
The bm3R1 and P450BM-3 genes form a cotranscriptional unit regulated by the bicistronic operator OIII.
Bm3R1 binds a sequence within the coding sequence of the gene bm3R1. This sequence is named BB3 (Barbie Box element):[(+364)ATCAAAAGCTGGTGG]Numbering refers to the translational start codon of the bm3R1 gene).
Barbie box elements are a type of DNA sequences 15-17 bp long, situated at the 5’ regulatory regions of all, eukariotic and prokaryotic genes that encode barbiturate-inducible proteins. All the Barbie box elements have a 4 bp sequence, AAAG, situated in the same relative position.
>44|Q9ZFU7|HTH-type transcriptional regulator eutR (Ethanolamine operon regulatory protein)|Salmonella typhimurium|AraC
The eut operon includes 17 genes. EutR is the last gene of the operon. There are two promoters in this operon, PI and PII. PII is adjacent to the eutR gene and appears to provide a low constitutive level of EutR regulator. The eutR gene can also be transcribed from the PI promoter at the begining of the eut operon.
>45|P26993|Exoenzyme S synthesis regulatory protein exsA|Pseudomonas aeruginosa|AraC
Pc promoter controls the operon containing exsC, exsB and exsA.
>69|O33813|Lactose operon transcription activator|Staphylococcus xylosus|AraC
LacR is transcribed from two promoters with different strengths. Expression from the strong promoter, P1, occurs independently of lactose in the growth medium, whereas initiation at the weaker promoter, P2, relies on lactose for induction. The transcription start point of P1 is located 35 bp from the lacR start codon, and the transcription start point of P2 is 22 bp upstream of the lacR start codon.
>72|P21308|HTH-type transcriptional regulator luxR|Vibrio harveyi|TetR
The luxR transcription start point was identified, by primer extension, 78 bp upstream of the start codon. The putative promoters sequence determined according to the transcription start point was TTGACC for the -35 and TACACT for the -10 sequeces, which were separated by 17 bp: [ttgaccTTGCACATATGCACCATtacactATCAGTg].
The promoter region of luxR seems well conserved with respect to potential sigma-70 promoter sequences and the transcription start sites.
Alignment of the promoter regions of the Vibrio harveyi luxR homologs revealed identical promoter sequence among them.
LuxR binds, with similar affinity to two sites upstream of its own open reading frame. One site is located between 52 and 107 bp upstream of, while the other site is located 25 downstream of the transcriptional start site.
Binding of LuxR displaces RNAP from the luxR promoter.
>73|P27246|Multiple antibiotic resistance protein marA|Escherichia coli O157:H7|AraC
The promoter of the marRAB operon is PmarII located in the marC-marR intergenic region.
>78|P10411|Melibiose operon regulatory protein|Escherichia coli O6|AraC
Promoter regulatory protein.
>82|P39897|HTH-type transcriptional regulator mtrR|Neisseria gonorrhoeae|TetR
The 250 bp region between mtrR and mtrC genes contains the promoters of both genes, divergently oriented and contiguous in their -35 boxes. The mtrR gene may start to be transcribed from two start points, the G 30 bp and the T 32 bp upstream from the first ATG codon, and the following -35 and -10 boxes, (-37)TTGCAC, 17, TATAAT(-9) (The numbering refer to the TSP 30 bp upstream from the first ATG): [ttgcacGGATAAAAGTCTTTTTtataatCCGCCCtCg]-> mtrR.
The promoter region of mtrR contains the following 13 bp inverted repeat sequence: (-27)AAAAAGTCTTTTT(-15) (The numbering refer to the TSP 30 bp upstream from the first ATG).
The 13 bp length of the inverted repeat is necessary for expression of the mtrR gene.
The MtrR repressor is capable of specifically binding the DNA sequence between mtrR and mtrC genes.
The binding site is located to a 26 bp stretch that includes the promoter used for mtrCDE transcription and on the complementary strand, a 22 bp stretch that contains the -35 region of the mtrR promoter. This has been determined by Dnase I footprinting analyses:[ TTTTTTATCCGTGCAATCGTGTATGT(-15)] (The numbering refer to the TSP 30 bp upstream from the first ATG). This MtrR binding site partially overlaps with the 13 bp inverted repeat sequence.
>93|P40883|Regulatory protein pchR|Pseudomonas aeruginosa|AraC
The heptameric CGTGGAT sequence, identified upstream of the putative -35 region of pchR could be the binding site for PchR.
>97|Q05587|Regulatory protein pocR|Salmonella typhimurium|AraC
The pduF gene is expressed from two regulated promoters (P1 and P2). The transcription from P1 and P2 extends beyond pduF to include the pocR gene.
>100|P23217|HTH-type transcriptional regulator qacR|Staphylococcus aureus subsp. aureus Mu50|TetR
The qacR-qacA intergenic region contains the promoter of both genes and an QacR operator sequence, IR1.
The qacR transcription start point is a C located 22 bp upstream of the first codon of qacR.
The qacR promoter sequence is: [ttattcTTTGAATTTTTTGTGCtatcatTGATAGTAc]-> qacR.
The QacR operator sequence, named IR1, is adjacent to the qacA promoter region.  IR1 is a 28 bp pseudopalindromic sequence that overlaps the qacA transcription start point (g). IR1 contains two 11 bp half-sites, wich are separated by a 6 bp  spacer. The sequence of IR1 is: [CTTATAgACCGATCGCACGGTCTATAAG].
>114|P16114|Regulatory protein rns|Escherichia coli|AraC
Rns positively regulates its own expression from Prns. Rns binding site 1 is centered at 227 upstream of the transcription start site, outside the promoter proximal region where activators of AraC/XylS typically bind.
However, there are two additional binding sites at bp +43 and at bp +8.
In vivo, the upstream binding site and one downstream site are required for Rns-dependent activation of its promoter despite the atypical location of these binding sites for an activator.
>120|P22539|Regulatory protein soxS|Escherichia coli O157:H7|AraC
The soxS promoter is within the 85-nucleotide intergenic region between the soxS and SoxR genes.
>122|P39885|HTH-type transcriptional regulator tcmR (Tetracenomycin C transcriptional repressor)|Streptomyces glaucescens|TetR
The tcmR gene has two promoters, tcmR-p1 and tcmR-p2.
The tcmR-p1 promoter has its transcription start point 6 bp upstream of the start codon of tcmR, whereas the tcmR-p2 promoter has it 109 bp upstream of the start codon of tcmR, within of the coding region of tcmA. The sequence of the tcmR-p1 is: tcmR<-[(-6)tTGGGAtagaacGCGGTGGACCACTGTGgacgta]. The sequence of tcmR-p2 is: tcmR<-[(-109)gGACGGCCTTTAGCAATccccctGCGACTTTACTCGTGCCtttgcg].
The close proximity of the transcriptional and translational start sites for the tcmR-p1 mRNA is unusual, but similar configurations have been reported for other Streptomyces genes.
It seems that p2 promoter is much weaker than p1 promoter.
The tcmR-p2 promoter is apparently constitutive, whereas the tcmR-p1 promoter is inducible by tetracenomycin C.
TcmR binds to the tcmA-tcmR intergenic region. The DNaseI footprint is:[(+5)CAACCCTATCTTGCGCCACCTGGTGACACCTGCATGCGATTGTCAAATGTCACTGACTGCTGTTAGCT](numbering refers to the first codon of the tcmR gene). This protected region contains two adjacent operator sequences, one of which overlaps the tcmA promoter and the other of which overlaps the tcmR-p1 promoter, perhaps separated by a few base pairs between the -35 regions of tcmA and tcmR-p1 promoters.
>124|P03038|Tetracycline repressor protein class A from transposon 1721|Escherichia coli|TetR
The tetR-tetA intergenic region contains the two overlapping promoters and two similar palindromic sequences that act as operators, tetO1 and tetO2.
tetO1 is 10 bp upstream from the transcription start site of the gene tetR. The sequence of tetO1 is: [(-10)TTTATCACTGATAAA(-24)].
tetO2 is 4 bp downstream from the transcriptional start site of the gene tetA. The sequence of tetO2 is: [(+4)TTATCAGTGATAA(+16)].
>126|P04483|Tetracycline repressor protein class B from transposon Tn10|Escherichia coli|TetR
The tetR-tetA intergenic region contains the two overlapping promoters and two similar palindromic sequences that act as operators, tetO1 and tetO2.
tetO1 is 8 bp upstream from the transcription start site of the gene tetR. The sequence of tetO1 is: [(-8)ACTCTATCATTGATAGAGT(-26)].
tetO2 is 1 bp downstream from the transcriptional start site of the gene tetA. The sequence of tetO2 is: [(+1)TCCCTATCAGTGATAGAGA(+19)].
>127|P03039|Tetracycline repressor protein class C|Escherichia coli|TetR
The tetR-tetA intergenic region contains the two overlapping promoters and two similar palindromic sequences that act as operators, tetO1 and tetO2.
tetO1 is 4 bp downstream from the transcription start site of the gene tetR. The sequence of tetO1 is: [(+4)TCGAATAGCTACTATTCGA(+22)].
tetO2 is 1 bp upstream from the transcriptional start site of the gene tetA. The sequence of tetO2 is: [(-1)AGTTTATCACAGTTAAATT(+18)].
>128|P09164|Tetracycline repressor protein class D|Escherichia coli|TetR
The tetR-tetA intergenic region contains the two overlapping promoters and two similar palindromic sequences that act as operators, tetO1 and tetO2.
tetO1 is 5 bp upstream from the transcription start site of the gene tetR. The sequence of tetO1 is: [(-5)CTCTATCATTGATAGGG(-21)].
tetO2 is 4 bp upstream from the transcriptional start site of the gene tetA. The sequence of tetO2 is: [(-4)CTCTATCAATGATAGGG(+13)].
>166|P07859|XylDLEGF operon transcriptional activator|Pseudomonas putida|AraC
Ps1 and Ps2. The XylS gene is constitutively expressed to a low level from the Ps2 promoter, which is a sigma 70-dependent promoter. The transcription initiation point of Ps2 maps 9 bp upstream of the proposed first ATG of the xylS gene.
>167|Q04710|XylDLEGF operon transcriptional activator 1|Pseudomonas putida|AraC
Ps1 (sigma 54 dependent promoter) and Ps2 (sigma 70 dependent promoter).
>170|Q05335|XYLDLEGF operon transcriptional activator 3|Pseudomonas putida|AraC
PxylS3. The transcription initiation point was mapped 178 bp upstream from the xylS3 ATG. The xylS3 promoter is probably a sigma 70 dependent promoter.
>245|O24739|BarB|Streptomyces virginiae|TetR
There are at least two BarA binding sites in the upstream region of barB.
>248|O30343|Hemagglutinin/protease regulatory protein|Vibrio cholerae|TetR
The hapR transcription start point is 77 bp upstream of the start codon. The putative promoters sequence is: [ttgaccTTGAATATATGCACCATtacactCATAGGGc].
The promoter region seems well conserved with respect to potential sigma-70 promoter sequences and the transcription start sites.
Alignment of the promoter regions of the Vibrio luxR homologs revealed identical promoter sequence among them.
>258|O52834|AlcR (Alcaligin siderophore system regulator)|Bordetella bronchiseptica|AraC
An iron-regulated transcription initiation site is located upstream of the alcR open-reading frame and adjacent to sequences homologous to the consensus Fur repressor binding site.
AlcR is transcribed primarily from the upstream iron-regulated alcA promoter but it is also independently transcribed from a weaker secondary iron-regulated promoter which retains its activity when the alcA promoter-operator region is deleted.
>262|O68276|Putative DNA-binding protein Bm1P1|Bacillus megaterium|TetR
Primer extension experiments demonstrated that the transcription start point for the bm1P1 gene is at position 48 bp upstream from the first codon of bm1P1.
This transcription start point is at an appropriate distance from the putative -10 and -35 sites similar to the consensus sequence of prokaryotic promoters:aTCTGCCTTTTCCTACGTGAattttaTCCTTTTTCCTTGATaaccaa.
The bm1P1/P450BM-1 intergenic region contains, besides the promoters of the two genes which ovelap in their -35 regions, two inverted repeat sequences, one with 53 bp that overlap the -10 region of the P450BM-1 promoter, and another 25 bp long that overlaps with the -35 regions of both promoters:TATACTATTA GTACATTTTTATACTAATTGTATAAAAATGTACTAATAGTATA (53bp), TTTTTCCTTGATAACCAAGTAAAAA (25bp).
Bm3R1 binds two sites between the P450BM-1 and bm1P1 genes. These sites are named OI and OII. OI covers the -35 regions of both promoters and OII covers the -10 region of the P450BM-1 promoter. These sites coincide with the inverted repeats, OI with the 25 bp inverted repeat and OII with the 53 bp inverted repeat.
>269|O70020|IcaR|Staphylococcus epidermidis|TetR
IcaR binds to the icaR-icaA intergenic region.
DNAseI footprint experiments in S. aureus show that IcaR binding protects a 42 bp DNA sequence immediately upstream from the ica A gene, that has a partial inverted repeat structure.
The equivalent regions in S. epidermidis SE5 and RP62A strains show identical structure.
There is a 5 bp sequence (TATTT) in the ica promoter region of S. aureus MN8 that is required for binding to at least one staphylococcal DNA-binding protein, different of IcaR. This unknown DNA-binding protein seems to be a repressor and the phenotype of the strain MN8m (with the five bp motif deletioned) result from the inability of this repressor to bind the altered ica promoter.
The equivalent regions in S. epidermidis SE5 and RP62A strains show a motif TATTA in the same position.
>278|P72185|Repressor protein|Propionibacterium freudenreichii|TetR
The 50 bp intergenic region between the hemX and hemR genes contains promoter-like sequences upstream from both genes, indicating that hemX and hemR may be transcribed divergently from overlapping promoters (in their -35 elements): hemX<-[ACaacataGGCGCGTAAGATAGtggacgcaaGCGATCACAATGAGtactttCG]->hemR.
>291|Q8KLP4|Repressor|Stenotrophomonas maltophilia|TetR
The transcription start point of the smeT gene is 30 bp upstream from the first SmeT codon, the -10 and -35 elements are:smeT<-[(-30)cCGACTtaacatGGCCAAATGtttgtt](complementary strand).
Smet is able to bind the intergenic smeT-smeD region.
There are an inverted repeat that partialy overlaps with the -35 elements of the promoter of both genes, smeT and smeD. The sequence of this inverted repeat is:[TACCGGTTTACAAACAAACAAGCATGTATGTATATTTCGCACCCATCAT(-88)](numbering from the first SmeT codon)(direct strand).
>310|Q8KX64|Luminescence regulator LitR|Vibrio fischeri|TetR
It has not found a clear -35 and -10 elements in the same location as the promoter regions of the others Vibrio harveyi luxR homologs, hapR, opaR and scmR.
>335|Q8VVJ2|TetR protein|Corynebacterium glutamicum|TetR
The intergenic region between tetR(33) and tetA(33) contains a 14 bp inverted repeat showing a 23 bp identity to the operator binding sites OL and OR of the TetR(A) protein from Tn1721: [TTTATCAtcGATAActTTATCgttGATAAG] (Uppercase means identity to the OL and OR from Tn1721).
>368|Q93M20|Putative transcriptional regulator|Streptomyces aureofaciens|TetR
There is a single promoter upstream the aur1A gene, aur1p1, that probably forms a polycistronic transcript.
The promoter region upstream the aur1A gene has a transcription start site 43 bp upstream of the aur1A translation initiation codon: [ttgaacGGCCGCTCGCGTCCGAAgaacctTGTAGTCaa(-43)].
The putative -10 and -35 regions of the aur1p1 promoter show partial similarity with consensus sequences of the promoters recognized by the Streptomyces principal sigma factor, sigmaHrdB, and its induction occurs at the initiation of morphological differentiation (aerial mycelium formation).
>387|Q46985|Regulator of the 4HPA-hydroxylase operon|Escherichia coli|AraC
Pa promoter: There are two  bands corresponding to A nucleotides located 60 bp (Pa2) and 107 bp (Pa1), upstream of the ATG codon of hpaA.
>393|Q51597|Cam repressor|Pseudomonas putida|TetR
The promoter region of camR is: [ttgttcGGGGCAGGCTCTATATCTGCGAtatactGAGCATAt].
The camR gene is transcribed by the RNA polymerase sigma-70.
CamR specifically binds to the camR/camD intergenic region.
The camR/camD intergenic region has a CamR binding site that serves as operator for the camR gene and the camDCAB operon. The DNaseI footprinting revelaed that CamR protected a 22 bp region that contains 6 bp inverted repeat sequences:[(-3)CTCAGTATATCGCAGATATAGAGCCT(-28)].
The Kd(app) for binding of the CamR protein to its operator was 1.5x10-7 M.
>405|Q56153|JadR2|Streptomyces venezuelae|TetR
Sequences matching the -10 and -35 consensus hexamers for typical vegetative promoters are present upstream of the jadr2 coding sequence but lack the correct spacing for RNA polymerase recognition.
>407|Q56790|HrpXv|Xanthomonas campestris pv. vesicatoria|AraC
The transcription start site is located 59 bp upstream from the A of the predicted ATG start codon. A sequence resembling the -10 box for sigma 70 dependent transcription in E. coli is present in the promoter region, but the corresponding -35 box is missing.
>408|Q56801|Hrp protein (Fragment)|Xanthomonas campestris|AraC
The region encompassing 580 bp upsteam the putative translation start site is sufficient for HrpXv function and contains the promoter. Sequence conservation up to position -84 suggests that this region might be sufficient for promoter activity.
>416|Q60011|Virginiae butanolide receptor|Streptomyces virginiae|TetR
BarA binds its DNA regulatory region.
>840|Q9AIQ9|IcaR|Staphylococcus caprae|TetR
DNAseI footprint experiments in S. aureus show that IcaR binding protects a 42 bp DNA sequence immediately upstream from the ica A gene that has a partial inverted repeat structure.
The equivalent region in S. caprae 96007 strain show identical structure.
There is a 5 bp sequence (TATTT) in the ica promoter region of S. aureus MN8 that is required for binding of at least one staphylococcal DNA-binding protein, different to IcaR. This unknown DNA-binding protein seems to be a repressor and the phenotype of the strain MN8m (with the five bp motifs deletened) result from the inability of this repressor to bind the altered ica.
The equivalent regions in S. caprae 96007 show a motif TATTA in the same position.
>841|Q9AIU0|Regulatory protein TtgR|Pseudomonas putida|TetR
The ttgR-ttgA intergenic region contains the promoter of each gene, PttgR and PttgA. The localion of the start sites indicates that the both promoters fully overlaps.
The -10 region of PttgR and PttgA exhibits some degree of similarity to promoters recognized by RNA polymerase with sigma 70 and lower similarities in their -35 regions.
The sequence of the PttgR is: [tagcttGCTAAGGAATATACTTAcattcaTGGTTg]->ttgR.
TtgR binds a 28 bp imperfect palindromic sequence in the ttgR-ttgA intergenic region, that covers from 18 bp upstream to 10 bp downstream of the ttgR transcription start site: [TACTTACATTCATATAAgGAATCGTTCG]. This 28 bp sequence overlaps with the -10 region of the ttgR promoter, the ttgR transcription start site, and the -35 region of the ttgA promoter.
>844|Q9AJL5|VarR|Streptomyces virginiae|TetR
The varS and varR genes constitute one operon and are cotranscribed with its promoter upstream of the varS gene.
It lacks a typical promoter sequence in the 5’untranslated region of varR.
VarR specifically binds to the 5’ upstream region of varS.
VarR does not bind to the 5’ upstream region of varR.
The binding of VarR to the 5’ upstream region of varS is specifically inhibited by the antibiotic virginiamycin S.
There are two adjacent VarR binding sites on the varS-varR promoter. These binding sites are two dyad sequences (-39 to -20 and -19 to +2) that share a consensus of 12 nucleotides: [5’-NCNTACNTNGTANAACN-3’]. Besides, the two sites together can form a large dyad structure with C at -19 as the center of symetry.
>852|Q9ANS7|LuxT|Vibrio harveyi|TetR
The luxT promoter region contains a putative -10 element but not a -35 element: [TAATGCTGAGGATGATTTTCATTCTGGCCTCAtttaatTGTGAGT..]->luxT.
>862|Q9EVJ6|Repressor protein MphR(A)|Escherichia coli|TetR
A single transcription start site is located 31 bp upstream from the translation initiation site of mph(A). There are -35 and -10 elements from this transcription start site that resemble the consensus sequences, TTGAat and TacAtT, repectively:[ttgaatATAACCGACGTGACTGTtacattTAGGTGg(-31)]-> mph(A).
The mph(A), mrx and mphR(A) genes form and operon and are cotranscribed from the promoter of the mph(A) gene.
MphR(A) specifically binds to the promoter region of mph(A).
MphR(A) binds to a DNA sequence that spans from nucleotide -3 to -37, that corresponds exactly to the promoter region of the mph(A) gene:[(-37)GAttgaatATAACCGACGTGACTGTtacattTAGG(-3)].
>866|Q9F0Y2|Pip|Streptomyces coelicolor|TetR
Two regulatory Pip binding motifs were found in the intergenic pip/pep region, upstream of the pep coding sequence. These sequences overlaps with the -35 and the -10 hexamers.
>903|Q9KIH5|Putative regulator|Rhizobium etli|TetR
The rmrR/rmrA intergenic region contains a potential rmrR promoter with -35 and -10 consensus sequences for sigma-70. The first nucleotide of the -10 region is situated 65 bp upstream from the start codon of rmrR: rmrR<-[(-65)cctaaaGTGTATTCCACCTGAattcaa].
The rmrR/rmrA intergenic region contains a potential rmrA promoter with -35 and -10 consensus sequence for sigma-70. The first nucleotide of the -10 region is situated at 88 bp from the start codon of rmrA: [ttgacaTTCTTTTTTTAAAGCAtatttt(-88)]->rmrA.
The rmrR/rmrA intergenic region contains a 25 bp inverted repeat sequence that overlaps with the -10 sequence of both promoters. This inverted repeat is a potential regulatory site: rmrR<-[tattttGGAAAACATCAAGTTTcctaaa]->rmrA.
>906|Q9KJC4|ArpR|Pseudomonas putida|TetR
The arpR/arpA intergenic region contains a putative sigma70-dependent promoter motif [tttacaAACAACCATGAATGTAAGtatatt].
>923|Q9L8G8|SmcR (VvpR)|Vibrio vulnificus|TetR
The transcription start point (TSP) of smcR was determined by primer extension as a G located 87 bp upstream of the start codon.
The promoter sequence determined according to the TSP was TTGACC for the -35 and TACACT for the -10 sequences, wich were separated by 16 bp: [ttgaccCAATGCATATCGCACCATtacactCATGGAg]->smcR.
The promoter region seems well conserved with respect to sequences recognized by RNA polymerase sigma-70.
Alignment of the promoter region of other Vibrio luxR homologues (LuxR V. harveyi, OpaR Vibrio parahaemolyticus, VanT Vibrio anguillarum and HapR Vibrio cholerae) revealed identical promoter sequence among them.
>1001|Q9X545|Tetracycline repressor protein TetR|Corynebacterium glutamicum|TetR
The tetR(Z)-tetA(Z) intergenic region contains the two 12 bp direct repeats with a 10 bp identity to the operator binding site of the tetracycline repressor TetR(A).
>1011|Q9XCC5|Hypothetical transcriptional regulator TylQ|Streptomyces fradiae|TetR
In the intergenic DNA upstream of tylQ exits a putative BARE-like consensus sequence (target for binding of BarA and other gamma-butyrolactone receptor proteins. May be that the binding of TylP to the promoter region of tylQ occurs to this putative sequence.
>1012|Q9XCC7|Gamma-butyrolactone receptor protein TylP|Streptomyces fradiae|TetR
In the intergenic DNA upstream of tylP exits a putative BARE-like consensus sequence (target for binding of BarA and other gamma-butyrolactone receptor proteins. Probably the binding of TylP to its own promoter region occurs to this putative sequence.
>1368|O30507|Arginine regulatory protein (Transcriptional regulator ArgR) (ArgR regulatory protein)|Pseudomonas aeruginosa|AraC
The argR gene, is a member of the aot operon coding for arginine transport genes.
>1383|O50285|OpaR|Vibrio parahaemolyticus|TetR
The opaR transcription start point was identified, by primer extension, 87 bp upstream of the start codon. The putative promoter sequence is:[ttgaccTTGTGCATATGCACCATtacactCATCACTg(-87)].
The promoter region of opaR exhibits features similar to those recognized by sigma-70.
Alignment of the promoter regions of the Vibrio luxR homologs revealed identical promoter sequence among them.
>1386|O52066|AlcR (Transcriptional regulator)|Bordetella pertussis|AraC
An iron-regulated transcription initiation site is located upstream of the alcR open-reading frame and adjacent to sequences homologous to the consensus Fur repressor binding site.
AlcR is transcribed primarily from the upstream iron-regulated alcA promoter but is also independently transcribed from a weaker secondary iron-regulated promoter which retains its activity when the alcA promoter-operator region is deleted.
>1431|O86852|Gamma-butyrolactone binding protein|Streptomyces coelicolor|TetR
The promoter region of scbR is situated in the coding region of scbA. The transcription start point (TSP or +1) is 124 bp upstream from the scbR start codon. The -35 and -10 boxes of scrR promoter are (-38)TTGGCA, 18, AAAACT(-7): ttggcaTCGGACGCAGAATTGATCaaaactACTGCTTc]->scbR.
Four bp upstream of the scbR -35 element of the scbR promoter is a 26 bp ScbR binding sequence, named ScbR binding site R: [(-68)GGAACCGGCAATGCGGTTTGTTCGAT(-42)](numbering from transcription start site).
>2160|Q53901|ActII protein (Putative transcriptional regulatory protein)|Streptomyces coelicolor|TetR
The actII-1 actII-2 intergenic region is a bidirectional promoter/operator region.
The actII-1 and actII-2/3 transcripts each have a single promoter and the promoters for the two transcripts overlap.
actII-2 and actII-3 are translationally coupled.
>4196|Q9F8V9|TetR family bacterial regulatory protein|Agrobacterium tumefaciens|TetR
It appears that ameR forms an operon with the upstream gene(s).
>4926|16077337|transcriptional regulator|Bacillus subtilis subsp. subtilis str. 168|TetR
The transcription start point of the gene lmrA is situated 42 bp upstream of the first codon of LmrA: [TTCtTGACAATTGATGATTGAATCAAgataatAGACCAg]->lmrA.
Many multdrug efflux systems contains a characteristic cis-acting regulatory element in the promoter. The inverted repeat sequence is extended from -18 to +18 bp (numbering to the transcription start point): [(+18)AATCAAgataatAGACCAgTCACTATATTTTTGATT(-18)].
>5460|15928251|ica operon transcriptional regulator IcaR|Staphylococcus aureus subsp. aureus N315|TetR
IcaR binds to the icaR-icaA intergenic region, a 42 bp-long sequence immediately upstream of the icaA gene:[ATATGGCTTACAACCTAACTAACGAAAGGTAGGTAAAGAAAT].
The exact IcaR-specific operator site has not yet been determined.
There is a 5 bp sequence (TATTT) in the ica promoter region that is bound by an  unknown repressor protein, different to IcaR, and the phenotype of strain MN8m results from the inability of this repressor to bind the altered ica promoter.
>6853|19552090|transcriptional regulator|Corynebacterium glutamicum ATCC 13032|TetR
There is a binding motif for AmtR, ATCTATAGN1-4ATAG.
One putative AmtR binding site was found upstream of amtR itself, however no AmtR binding to this sequence was detected in gel retardation experiments.
AmtR binds upstream of the amt gene.
Another putative AmtR binding site was found upstream of amtB. The binding was shown by gel shift experiments.
>9416|O24741|FarA|Streptomyces sp. FRI-5|TetR
The transcriptional start site (TSP) of farA is located 64 bp upstream of the translational start codon.
Five base pairs upstream from the TSP lies the hexameric sequence TAAGAT and 16 bp upstream lies the motif TTGGCG; these sequences may act as the -10 and -35 regions, respectively, of the farA promoter: ttggcgTTGGCATCACCCGCTGtaagatACGAa.
The FarA binding site is a sequence of 28 bp situated 70 bp upstream of the translational start codon: [(-7)-GATACGAACGGGACGGACGGTTTGCAGC-(+21)]. This sequence is named FARE (FarA-responsive element). FARE covers the farA transcription start site and partially overlaps the -10 region of farA promoter.